View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7301_low_11 (Length: 249)
Name: NF7301_low_11
Description: NF7301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7301_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 67 - 178
Target Start/End: Complemental strand, 37992773 - 37992664
Alignment:
| Q |
67 |
gctcatttttgcatgaagtaaaattaatcccctttttgtgtttcaatannnnnnnnnnnagaggaaggcaaataacgtcaattttgttttcaacttgtgg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37992773 |
gctcatttttgcatgaagtaaaattaatcccctttttgtgtttcaata-ttttttttttagaggaaggcaaataac-tcaattttgttttcaacttgtgg |
37992676 |
T |
|
| Q |
167 |
actatccttttt |
178 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37992675 |
actatccttttt |
37992664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 37991545 - 37991483
Alignment:
| Q |
171 |
tccttttttatgttt-gagagtaactttttaatgagcttgtatcttgggttctttttcaggat |
232 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37991545 |
tccttttttatgttttgagagtaactttttaatgagcttgtatcttgggttctttttcaggat |
37991483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 37992832 - 37992791
Alignment:
| Q |
1 |
cttctaaagtttaaacttagaattatctatcacatttattaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37992832 |
cttctaaagtttaaacttagaattatctattacatttattaa |
37992791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University