View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7302_high_7 (Length: 297)
Name: NF7302_high_7
Description: NF7302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7302_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 278
Target Start/End: Original strand, 33155256 - 33155518
Alignment:
| Q |
16 |
ctggcaaatttctcggttttgtttcaaagaccaactggtcgaatcgaaatgacaagggcgtcagagtttccgattatatggaggctccaccgggttctct |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
33155256 |
ctgggaaatttctcggttttgtttcaaagactaactggtcgaatcgaaatgacaagggcgtcagagtttcccattatatggaggctccaccaggttctct |
33155355 |
T |
 |
| Q |
116 |
accgtggaactctgaccttgcaaaaattgaagaggaaatgaagaagagaaatggaaatcttgttgctttggtgaaggatgaagtggtggtggatttggtg |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33155356 |
accgtggaactctgaccttgcggaaattgaagaggaaatgaataagagaaatggaaatattgttgctttggtgaaggatgaagaggtggtggatttggtg |
33155455 |
T |
 |
| Q |
216 |
acaaaagaggaggttgagagggtcagaggctatccgaagttggtgaccggaggatcgattggg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33155456 |
acaaaagaggaggttgagagggtcagaggctatccgaagttggtgaccggaggatcggttggg |
33155518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University