View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7302_low_14 (Length: 228)
Name: NF7302_low_14
Description: NF7302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7302_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 33490029 - 33490230
Alignment:
| Q |
18 |
gaggaatcatcacatttccaatttggcatgatatccatga---tcccacctaagttttgtacatataccctttgaacaattattacctggcgatgtcgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || |||||||||| |
|
|
| T |
33490029 |
gaggaatcatcacatttccaatttggcatgatatccatgatgatcccacctaagttttgtacatacaccctttgaacaattattacatgtcgatgtcgat |
33490128 |
T |
|
| Q |
115 |
tctgaaagacaaaacctaaaccactttggctcggataattttcttcttggctatgaagaaaattattaattgcttaaaaattgctacccgtcagatattc |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
33490129 |
tctgaaagacaaaatctaaaccactttggctcggataattttcttcttggctatgaagaaaa-tgttatttgcttaaaaattgctacccgtcagattttc |
33490227 |
T |
|
| Q |
215 |
ttc |
217 |
Q |
| |
|
||| |
|
|
| T |
33490228 |
ttc |
33490230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University