View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7303_high_8 (Length: 242)
Name: NF7303_high_8
Description: NF7303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7303_high_8 |
 | |
|
| [»] scaffold0143 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 33518692 - 33518469
Alignment:
| Q |
15 |
cacatcttcatccaaaacatatagtatatttttggatcaaggattttggaagacaaaatttaggtctatgtttggatcaaggattttggaggactaactc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33518692 |
cacatcttcatccaaaacatatagtatatttttggatcaaggattttggaagacaaaatttaggtctatgtttggatcaaggattttggaggactaactc |
33518593 |
T |
|
| Q |
115 |
tagtaatgaacaaagcaattgaatagttctacttgtattaattgtgttaaacttgtttaattattaaatgctgtgtttttctcccttttagagcatgatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33518592 |
tagtaatgaacaaagcaattgaatagttctacttgtattaattgtgttaaacttgtttaattattaaatgctgtgtttttctcccttttagagcatgatg |
33518493 |
T |
|
| Q |
215 |
tctggatcaacctctaaataagat |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33518492 |
tctggatcaacctctaaataagat |
33518469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 103 - 2
Alignment:
| Q |
15 |
cacatcttcatccaaaacatatagtatatttttggatcaaggattttggaagacaaaatttaggtctatgtttggatcaaggattttggaggactaactc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103 |
cacatcttcatccaaaacatatagtatatttttggatcaaggattttggaagacaaaatttaggtctatgtttggatcaaggattttggaggactaactc |
4 |
T |
|
| Q |
115 |
ta |
116 |
Q |
| |
|
|| |
|
|
| T |
3 |
ta |
2 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University