View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7303_low_4 (Length: 431)
Name: NF7303_low_4
Description: NF7303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7303_low_4 |
 | |
|
| [»] scaffold0562 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0562 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 154 - 332
Alignment:
| Q |
1 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
253 |
T |
|
| Q |
101 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgtcgccgga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
254 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgttgccgga |
332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562; HSP #2
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 240 - 414
Target Start/End: Original strand, 393 - 567
Alignment:
| Q |
240 |
gcttcatggaccttcctctacctcttccgtcctaccgatcgtcctctcgttctcttcggtcgcactttcaccgattttgaaacgcttatgatcctctcag |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
393 |
gcttcatggaccttcctctacctcttccgtcctaccgatcgtcctctcgttctcttcggtcgcactttcaccgattttgaaacgcttatgatcctctcag |
492 |
T |
|
| Q |
340 |
gactcacgatcttcgtcgttttcctcaccagtgttggatctgttcttgtttccgctttaatgctcggtgtctctg |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493 |
gactcacgatcttcgtcgttttcctcaccagtgttggatctgttcttgtttccgctttaatgctcggtgtctctg |
567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 3898905 - 3899083
Alignment:
| Q |
1 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898905 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
3899004 |
T |
|
| Q |
101 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgtcgccgga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3899005 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgttgccgga |
3899083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 240 - 414
Target Start/End: Original strand, 3899144 - 3899318
Alignment:
| Q |
240 |
gcttcatggaccttcctctacctcttccgtcctaccgatcgtcctctcgttctcttcggtcgcactttcaccgattttgaaacgcttatgatcctctcag |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3899144 |
gcttcatggaccttcctctacctcttccgtcctaccgatcgtcctctcgttctcttcggtcgcactttcaccgattttgaaacgcttatgatcctctcag |
3899243 |
T |
|
| Q |
340 |
gactcacgatcttcgtcgttttcctcaccagtgttggatctgttcttgtttccgctttaatgctcggtgtctctg |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3899244 |
gactcacgatcttcgtcgttttcctcaccagtgttggatctgttcttgtttccgctttaatgctcggtgtctctg |
3899318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 255 - 304
Target Start/End: Complemental strand, 36033939 - 36033890
Alignment:
| Q |
255 |
ctctacctcttccgtcctaccgatcgtcctctcgttctcttcggtcgcac |
304 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
36033939 |
ctctacctcttccgtccttccgatcaacctctcgttctcttcggacgcac |
36033890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University