View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7304_low_1 (Length: 249)
Name: NF7304_low_1
Description: NF7304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7304_low_1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 249
Target Start/End: Complemental strand, 22042876 - 22042649
Alignment:
| Q |
24 |
atgcttattcctctgtcattcctgctccaacttttattccatctcacatatgcaacttgggttttctctccatatat--ctttctatataaaccatatat |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||| |||| | | |
|
|
| T |
22042876 |
atgcttattcctctgccattcctgctccaacttttattccatctcacatatgcaacttggcttttctctccatatatatctttatatataacccatctct |
22042777 |
T |
 |
| Q |
122 |
tgacataattgaatgttcacaataaaaaatataactacatcatctttcacaactctttccacttcaaatggctggatatcgtgttgtacttaaaagacaa |
221 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22042776 |
tgacattattgcatcttcacaataaaaaatataactacatcatctttaacaactctttccacttcaaatggctggatatcgtgttgtacttaaaagacaa |
22042677 |
T |
 |
| Q |
222 |
gttttgggaggttttgaaactgtacatc |
249 |
Q |
| |
|
|| | |||||||||||||||||||||| |
|
|
| T |
22042676 |
attctaggaggttttgaaactgtacatc |
22042649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University