View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7305_low_2 (Length: 249)
Name: NF7305_low_2
Description: NF7305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7305_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 358645 - 358426
Alignment:
| Q |
19 |
tgtttaactcgagttgattaattttattgaaaatatannnnnnnaaaaacttaattatgaatgaatattttacaacgaaagatacaaaaaagaatatttg |
118 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
358645 |
tgtttaactcgcgttgattaatcttattgaaaatatatttttttaaaaacttaagtatgaatgaatattttacaacaaaagatacaaaaaaaaatatttg |
358546 |
T |
 |
| Q |
119 |
aataattacaaactttattgatttgtgcaaaacaccaaaattcttatgaccaagaacaatgtggaaaggtagggatatccaaatgtcatttttgttacca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
358545 |
aataattacaaactttattgatttgtgcaaaacaccaaaattcttatgaccaagaactatgtggaaaggtagggatatccaaatgtcatttttgttacca |
358446 |
T |
 |
| Q |
219 |
ttaaacgtctcaagcaacac |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
358445 |
ttaaacgtctcaagcaacac |
358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 93
Target Start/End: Complemental strand, 37147924 - 37147863
Alignment:
| Q |
32 |
ttgattaattttattgaaaatatannnnnnnaaaaacttaattatgaatgaatattttacaa |
93 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
37147924 |
ttgattaattgtattgaaaatatatttttaaaaaaccttaattataaatgaatattttacaa |
37147863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University