View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7308_low_22 (Length: 205)
Name: NF7308_low_22
Description: NF7308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7308_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 6732019 - 6731949
Alignment:
| Q |
35 |
aatagggtgtccgcgtgaatgctag----tataaaagaagaaaaatccaaagcctttcttttgtgagatag |
101 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6732019 |
aatagggtgtccgtgtgaatgctagctagtataaaagaagaaaaatccaaagcctttcttttctgagatag |
6731949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University