View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_high_22 (Length: 287)
Name: NF7309_high_22
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_high_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 52843764 - 52844033
Alignment:
| Q |
18 |
aagatgagcgaggagcaaggaggaaacaatgttccttattcaaatggcaaagaagagagaatttatgttgcaattagagtaaggcctttgaatgnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52843764 |
aagatgagcgaggagcaaggaggaaacaatgttccttattcaaatggcaaagaagagagaatctatgttgcaattagagtaaggcctttgaatgaaaaag |
52843863 |
T |
 |
| Q |
118 |
nnnnnncgaggcaggatgtttcagaatgggaatgtgtttctcatagcacgatcaaattcaagaacaatggtcatgcagaacagcgatcatcgccggatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52843864 |
aaaaaacgaggcaggatgtttcagaatgggaatgtgtttctcatagcacgatcaaattcaagaacaatggtcatgcagaacagcgatcatcgccggatac |
52843963 |
T |
 |
| Q |
218 |
atatacatttggtagtaaacatgttcattatgttgatttgtttgttgtagttataatttattaaactttg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52843964 |
atatacatttggtagtaaacatgttcattatgttgatttgtttgttgtagttataatttatgaaactttg |
52844033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University