View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_high_30 (Length: 241)
Name: NF7309_high_30
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 37244838 - 37244611
Alignment:
| Q |
1 |
aatggtgttaagaatacttctttggaggagttgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttgaagaaattgatgatgggggattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37244838 |
aatggtgttaagaatacttctttggaggaattgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttgaagaaattgatgatgggggattag |
37244739 |
T |
|
| Q |
101 |
attcttggaagccagctttagatagtattcctgaggatcactccatgaagctatagggagt-aattgttataaccaatcctatattatgtaaataaagac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| || | |||||||||||||||||||||||||| |
|
|
| T |
37244738 |
attcttggaagccagctttagatagtattcctgaggatcactccatgaagctataggtagtaaattgtcatgaacaatcctatattatgtaaataaagac |
37244639 |
T |
|
| Q |
200 |
aatatatgtttttatttatttgatagtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37244638 |
aatatatgtttttatttatttgatagtg |
37244611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University