View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_high_33 (Length: 237)
Name: NF7309_high_33
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 6252782 - 6252574
Alignment:
| Q |
16 |
attcagacactgctgctagaaatgcatacgcttgtttaataatggtagaatcttcgtaaaacatgccaattgatggcaatcaggaattgtatccaacacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6252782 |
attcagacactgctgctagaaatgcatacgcttgtttaataatggtagaatcttcgtaaaacatgccaattgatggcaatcaggaattgtatccaacacc |
6252683 |
T |
|
| Q |
116 |
aagttatgatgtaaattttgattcaaaagaatttggtaactatatggtaaagggagaagttgagaaatggagtgaaaaatcagactttcatagagatact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6252682 |
aagttatgatgtaaattttgattcaaaagaatttggtaactatatggtaaagggagaagttgagaaatggagtgaaaaatcagactttcatagagatact |
6252583 |
T |
|
| Q |
216 |
tgtgaaatt |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
6252582 |
tgtgaaatt |
6252574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University