View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_high_36 (Length: 219)
Name: NF7309_high_36
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 29661386 - 29661195
Alignment:
| Q |
17 |
gtttcgaattggggtctcagttaatagaaaggggtatgattgttgcagttaggaagagttcaattttttaatataggttatcttctacttttcctattta |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29661386 |
gtttcgaattggggtctcggttaatagaaaggggtatgattgttgcagttaggaagagttcaattttttaatataggttatcttctacttttcctattta |
29661287 |
T |
 |
| Q |
117 |
cttgcagaagaccaacattattttcactgttttagatctccgcctatccttttcactgtgcatctcttgtgttctgctaaatagcatatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29661286 |
cttgcagaagaccaacattattttcactgttttagatctccgcctatccttttcactgtgcatctcttgtgttctgccaaatagcatatatt |
29661195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University