View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7309_high_37 (Length: 218)

Name: NF7309_high_37
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7309_high_37
NF7309_high_37
[»] chr2 (2 HSPs)
chr2 (121-204)||(19995443-19995526)
chr2 (123-204)||(19995265-19995346)
[»] chr3 (2 HSPs)
chr3 (117-204)||(8322983-8323070)
chr3 (17-72)||(8323126-8323181)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 121 - 204
Target Start/End: Complemental strand, 19995526 - 19995443
Alignment:
121 ttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
19995526 ttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgcatgtttggagcttttcaagaagttcttct 19995443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 204
Target Start/End: Complemental strand, 19995346 - 19995265
Alignment:
123 cttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct 204  Q
    |||| |||||||||||||||||   ||||||||||||||||||| ||||||  |  ||||||||||||| | ||||||||||    
19995346 cttaatcctgatggagatggataagttcttgtgtgtttgcattttcagattacacttttggagcttttccataagttcttct 19995265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 117 - 204
Target Start/End: Complemental strand, 8323070 - 8322983
Alignment:
117 attcttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct 204  Q
    ||||||| || ||||||||||||||||||| ||||||||||||||||||| ||||||| |  ||| |||||||| |||||||||||||    
8323070 attcttcatagtcctgatggagatggatctgttcttgtgtgtttgcattttcagattgcacttttagagctttttaagaagttcttct 8322983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 8323181 - 8323126
Alignment:
17 aattttcagtttactagttggatgagtatgcctatttatgaagctgattatggatg 72  Q
    |||||| | ||||||||||||||||||||||||||||| |||||||||| ||||||    
8323181 aattttaattttactagttggatgagtatgcctatttacgaagctgattttggatg 8323126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University