View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_low_31 (Length: 269)
Name: NF7309_low_31
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 32604876 - 32604636
Alignment:
| Q |
13 |
aatattaatgtttataaggtggaggtaggatccttgaggtgagacacaagggatgtccatttttatgaatggcatatgacacgatcaacttgatcaacag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604876 |
aatattaatgtttataaggtggaggtaggatccttgaggtgagacacaagagatgtccatttttatgaatggcatatgacacgatcaacttgatcaacag |
32604777 |
T |
|
| Q |
113 |
agacgcgtgccgtcgtttaatttgtcttgggaatttacnnnnnnngaaaatgttggtttcaacccatgtcaaatctcgtcacacattttgctaacatcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32604776 |
agacgcgtgccgtcgtttaatttgtcttgggaatttactttttttg-aaatgttggtttcaacccatgtcaaatctcgtcgcacattttgctaacatcat |
32604678 |
T |
|
| Q |
213 |
tgtacgttcgaccttccattttctatcgtatgtgcaatctga |
254 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
32604677 |
tgtgcgttcgaccttccattttctatggtatgtgcaacctga |
32604636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University