View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_low_32 (Length: 268)
Name: NF7309_low_32
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 40617982 - 40618071
Alignment:
| Q |
1 |
ttcattctaaactataatatatttttggcatgtcatacaagagaaatatacttagttttagatgggaaagataaattatgaattatttta |
90 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40617982 |
ttcattctaaactataagatatttttggcatgtcatacaagagaaatatacttaattttagatgggaaagataaattatgaattgtttta |
40618071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 175 - 257
Target Start/End: Original strand, 40618155 - 40618237
Alignment:
| Q |
175 |
ggttcgttgatattttaaaatcatttatagtttgagacaatattcttatgtaaagtgagtacaattcgagacagagaagtatt |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40618155 |
ggttcgttgatattttaaaatcatctatagtttgagacaatatttttatgtaaagtgagtacaattcgggacagaggagtatt |
40618237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University