View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_low_34 (Length: 261)
Name: NF7309_low_34
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 39420100 - 39420007
Alignment:
| Q |
1 |
gcagctttttcttttataaatagcagagttcgttccaagcattaaacagagcacactctgtcttgcattgcaggtaccactttgctctttggtt |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39420100 |
gcagctttttcttttatatatagcagagttcgttccaagcattaaacagagcacactctgtcttgcattgcaggtaccactttgctctttggtt |
39420007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 197 - 261
Target Start/End: Complemental strand, 39419904 - 39419840
Alignment:
| Q |
197 |
atacccatgccttcccactccatcgccaccaccctcacttcgccactcacaactacagagatgct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39419904 |
atacccatgccttcccactccatcgccaccaccctcacttcgccactcacaactacagagatgct |
39419840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University