View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_low_35 (Length: 259)
Name: NF7309_low_35
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_low_35 |
 |  |
|
| [»] scaffold0075 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0075 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 15834 - 16083
Alignment:
| Q |
1 |
tttgatagcaaaattcaactgtgaggtcatttcaattgcaaaaggtgcaaaaccatgaaccaatcttgtgaaaagagttaccaaaggaccctttaccatg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15834 |
tttgataggaaaattcaactgtgaggtcatttcaattgcaaaaggtgcaaaaccatgaaccaatcttgtgagaagagttaccaaaggaccctttaccatg |
15933 |
T |
 |
| Q |
101 |
accttgggctttcttgtgtcagaagcatcgatcaatatgctacgatcttcaacattggacacagatgaagaagtagaattattggtttcttcttgaacac |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15934 |
accttgggctttcttgtgtcagaatcatcgatcaatatgctacgatcttcaacaatggacacagatgaagaagtagaattattggtttcttcttgaacac |
16033 |
T |
 |
| Q |
201 |
caatagaatacaccttgttaatagatggaagcggacccatgagcaacacc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16034 |
caatagaatacaccttgttaatagatggaagtggacccatgagcaacacc |
16083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University