View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7309_low_48 (Length: 218)
Name: NF7309_low_48
Description: NF7309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7309_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 121 - 204
Target Start/End: Complemental strand, 19995526 - 19995443
Alignment:
| Q |
121 |
ttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19995526 |
ttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgcatgtttggagcttttcaagaagttcttct |
19995443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 204
Target Start/End: Complemental strand, 19995346 - 19995265
Alignment:
| Q |
123 |
cttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct |
204 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||| | ||||||||||||| | |||||||||| |
|
|
| T |
19995346 |
cttaatcctgatggagatggataagttcttgtgtgtttgcattttcagattacacttttggagcttttccataagttcttct |
19995265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 117 - 204
Target Start/End: Complemental strand, 8323070 - 8322983
Alignment:
| Q |
117 |
attcttcttactcctgatggagatggatctattcttgtgtgtttgcatttccagattgtatgtttggagcttttcaagaagttcttct |
204 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||||||||||||||||||| ||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
8323070 |
attcttcatagtcctgatggagatggatctgttcttgtgtgtttgcattttcagattgcacttttagagctttttaagaagttcttct |
8322983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 8323181 - 8323126
Alignment:
| Q |
17 |
aattttcagtttactagttggatgagtatgcctatttatgaagctgattatggatg |
72 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
8323181 |
aattttaattttactagttggatgagtatgcctatttacgaagctgattttggatg |
8323126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University