View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7310_low_14 (Length: 299)
Name: NF7310_low_14
Description: NF7310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7310_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 10146220 - 10146083
Alignment:
| Q |
18 |
aattgtgaaactaaatcgcttaatcaatctgaaatccttcgtgttttcatttcttgaaggttggttagattagtaatgatcttgtattatatatagtttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| | | | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10146220 |
aattgtgaaactaaatcgcttaatcaatgtgttttcctt-gagagtcgatttcttgaaggttggttagattagtaatgatcttgtattatatatagtttt |
10146122 |
T |
 |
| Q |
118 |
cgaatttcacatgtatttgataaaccctgctgcatttgg |
156 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10146121 |
ccaatttcacatgtatttggtaaaccctgctgcatttgg |
10146083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 198 - 284
Target Start/End: Complemental strand, 10146085 - 10145999
Alignment:
| Q |
198 |
tggcgaacggaacagtgaagtgagcagagagctatggagggaaagatgaaagtctgcattcgttaacttagataccactttcttcta |
284 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10146085 |
tggcgaacggaatagtgaagtgagcagagagctatggaaggaaagatgaaagtctgcattcgttaacttagataccactttcttcta |
10145999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University