View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_30 (Length: 334)
Name: NF7311_high_30
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 323
Target Start/End: Original strand, 8332205 - 8332512
Alignment:
| Q |
19 |
agtgaaactgaaatctctctcaaaccatcccaaaaaactatgtcttcatctt---cttcttcttctcctagtagcggagttgtggacactaacccttcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8332205 |
agtgaaactgaaatctctctcaaaccatcccaaaaaactatgtcttcatcttcttcttcttcttctcctagtagcggagttgtggacactaacccttcac |
8332304 |
T |
 |
| Q |
116 |
aaccttctgatgtgcgaacttttcgccgccgtttagattctcatcagactcccgagatgagcctaaaagcacctgtggtgagaccttatgttcgatcaaa |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8332305 |
aaccttctgatgtgccaatttttcgccgccgtttagattctgatcagactccagagatgagtctaaaagcacctgtggtgagaccttatgttcgatcaaa |
8332404 |
T |
 |
| Q |
216 |
gttgcctcggcttcgttggacaccagatcttcaccgttgctttgtgcatgcagttcaaaggcttggaggagaagatagtaagctacactagttcttttta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8332405 |
gttgcctcggcttcgttggacaccagatcttcaccgttgctttgtgcatgcagttcaaaggcttggaggagaagatagtaagctacactagttcttttta |
8332504 |
T |
 |
| Q |
316 |
tcaatatt |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
8332505 |
tcaatatt |
8332512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 297
Target Start/End: Original strand, 35848308 - 35848403
Alignment:
| Q |
202 |
tatgttcgatcaaagttgcctcggcttcgttggacaccagatcttcaccgttgctttgtgcatgcagttcaaaggcttggaggagaagatagtaag |
297 |
Q |
| |
|
|||||| |||||||| ||||| ||||||| ||||| || |||||||| | | |||| ||||||| ||| ||||||||||||| |||| |||||| |
|
|
| T |
35848308 |
tatgttagatcaaagatgcctaggcttcggtggactcctgatcttcatcactcctttatgcatgctgttgaaaggcttggaggccaagagagtaag |
35848403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 25679695 - 25679639
Alignment:
| Q |
192 |
ggtgagaccttatgttcgatcaaagttgcctcggcttcgttggacaccagatcttca |
248 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||| |||| |||||||| || |||||||| |
|
|
| T |
25679695 |
ggtgagaccttatgttagatccaagtttcctaggctacgttggactcctgatcttca |
25679639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University