View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_48 (Length: 250)
Name: NF7311_high_48
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 54689414 - 54689631
Alignment:
| Q |
19 |
atcacatgcatgcccctctaattatattgccccttagcactaccagttgaattttaaaatataaaatacgattcttgtctcctgtaattatttgctttat |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54689414 |
atcacatgcacgcccctctaattatattgccccttagcactaccagttgaattttaaaatataaaatacgattcttgtctcctgtaattatttgctttat |
54689513 |
T |
|
| Q |
119 |
attgagaagataacaactactataaccctgacatgttttctgatctcatagtcatctttctttttcagacaagagaaaatggaagttgctgtagaaacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54689514 |
attgagaagataacaactactataaccctgacatgttttctgatctcatagtcatctttctttttcagacaagagaaaatggaagttgctgtagaaacaa |
54689613 |
T |
|
| Q |
219 |
acctcaaaagctctctgc |
236 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
54689614 |
accccaaaagctctctgc |
54689631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University