View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_52 (Length: 247)
Name: NF7311_high_52
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 230
Target Start/End: Original strand, 7357347 - 7357556
Alignment:
| Q |
22 |
gacgacccataaacgaagaaagaagattgatgtgtgtttagagagttgtgtgttcaagaatgttccgtcgaagatcgacattgttgctggaaaatggatc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7357347 |
gacgacccataaacgaagaaagaagattgatgtgtgtttagagagttgtgtgtttaggaatgttccgtcgaagatcgacattgttgctggaaaatggatc |
7357446 |
T |
|
| Q |
122 |
ggcggagatactgggttgcggtggtttcgttgggaaatgagat-nnnnnnnttgattttgcagcaaaggatgatctaatagtgatattttagaaaatggg |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
7357447 |
ggcggagatactgggtcgcggtggtttcgctgggaaatgagataaaaaaaattgattttgcggcaaaggaggatctaatagtgatattttagaaactggg |
7357546 |
T |
|
| Q |
221 |
ttgcattgat |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
7357547 |
ttgcattgat |
7357556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 22 - 230
Target Start/End: Original strand, 29791476 - 29791682
Alignment:
| Q |
22 |
gacgacccataaacgaagaaagaagattgatgtgtgtttagagagttgtgtgttcaagaatgttccgtcgaagatcgacattgttgctggaaaatggatc |
121 |
Q |
| |
|
||||||||||| ||| ||| |||||| ||||||||||| |||||||||||||| | ||||||||| ||||||||||||| |||| ||||||||| || |
|
|
| T |
29791476 |
gacgacccatacacggagaccgaagatcgatgtgtgtttggagagttgtgtgttgaggaatgttccatcgaagatcgaca---ttgccggaaaatgggtc |
29791572 |
T |
|
| Q |
122 |
ggcggagatactgggttgcggtggtttcgttgggaaatgaga-tnnnnnnnttgattttgcagcaaaggatgatctaatagtgatattttagaaaatggg |
220 |
Q |
| |
|
| |||||||||||||| ||||| ||||| ||||||||||| ||||||||| || ||||| ||||||||| ||| |||||||||| |||| |
|
|
| T |
29791573 |
gccggagatactgggtcgcggttatttcgccgggaaatgagagaaaaaaaggtgattttgcggcgaaggaggatctaataatgagattttagaaactggg |
29791672 |
T |
|
| Q |
221 |
ttgcattgat |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
29791673 |
ttgcattgat |
29791682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University