View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_64 (Length: 235)
Name: NF7311_high_64
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 134 - 219
Target Start/End: Complemental strand, 23937240 - 23937155
Alignment:
| Q |
134 |
aatgattgaaatgctcatggtcatgataacaaaccttttgaaataaaatcaaaatagagaataactacacttaagtaggaaaataa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23937240 |
aatgattgaaatgctcatggtcatgataacaaaccttctgaaataaaatcaaaatagagaataactacacttaagtaggaaaataa |
23937155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University