View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_73 (Length: 214)
Name: NF7311_high_73
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_73 |
 | |
|
| [»] scaffold1821 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 118
Target Start/End: Original strand, 41068620 - 41068721
Alignment:
| Q |
17 |
aatatgggtcatgagattcagggttctttttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| | ||| |||||||||||||||| |||||| |
|
|
| T |
41068620 |
aatatgggtcatgagattcagggttctttttggttagtctcgctacgggctgagttgcatatggatttctttcgagatagaattggtctacccgattata |
41068719 |
T |
|
| Q |
117 |
ga |
118 |
Q |
| |
|
|| |
|
|
| T |
41068720 |
ga |
41068721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 19936076 - 19936015
Alignment:
| Q |
17 |
aatatgggtcatgagattcagggttctttttggttagtctcgctgccggctgagttggatat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19936076 |
aatatgggtcatgagattcagggttctttttggttagtctcgctgcctgctgagttgcatat |
19936015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 118
Target Start/End: Complemental strand, 38302724 - 38302663
Alignment:
| Q |
57 |
cgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattataga |
118 |
Q |
| |
|
|||| ||||| |||||| |||||||||||||| ||| ||||||||| ||| |||||||||| |
|
|
| T |
38302724 |
cgcttccggcggagttgcatatggatttctatcgagatagaattggcttactcaattataga |
38302663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 118
Target Start/End: Complemental strand, 26421347 - 26421245
Alignment:
| Q |
16 |
gaatatgggtcatgagattcagggttctttttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattat |
115 |
Q |
| |
|
||||||||||||||||||| | |||| | ||||||||| | |||| | ||||||||| |||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
26421347 |
gaatatgggtcatgagatttaaggttttatttggttagacacgcttcaagctgagttgcatatggatttctttcgagatagaattggtctacccaattat |
26421248 |
T |
|
| Q |
116 |
aga |
118 |
Q |
| |
|
||| |
|
|
| T |
26421247 |
aga |
26421245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 63
Target Start/End: Original strand, 8480154 - 8480200
Alignment:
| Q |
17 |
aatatgggtcatgagattcagggttctttttggttagtctcgctgcc |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8480154 |
aatatgggtcatgagattcagggttctttttggttagtctcgttgcc |
8480200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1821 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold1821
Description:
Target: scaffold1821; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 118
Target Start/End: Original strand, 789 - 862
Alignment:
| Q |
45 |
tttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattataga |
118 |
Q |
| |
|
||||||||| | |||| || ||||||||| ||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
789 |
tttggttaggcacgcttccagctgagttgtttatggatttctattgtgacataattggtctacccaattataga |
862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 118
Target Start/End: Original strand, 22955573 - 22955646
Alignment:
| Q |
45 |
tttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattataga |
118 |
Q |
| |
|
||||||||| | |||| || ||||||||| |||| |||||||||| | | |||||||||||||||||||||| |
|
|
| T |
22955573 |
tttggttagacacgcttccagctgagttgtttatgcatttctattgtgacataattggtctacccaattataga |
22955646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 118
Target Start/End: Complemental strand, 23832819 - 23832746
Alignment:
| Q |
45 |
tttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattataga |
118 |
Q |
| |
|
||||||||| | |||| || ||||||||| |||| |||||||||| | | |||||||||||||||||||||| |
|
|
| T |
23832819 |
tttggttagacacgcttccagctgagttgtttatgcatttctattgtgacataattggtctacccaattataga |
23832746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 118
Target Start/End: Original strand, 27177407 - 27177480
Alignment:
| Q |
45 |
tttggttagtctcgctgccggctgagttggatatggatttctattgaggtagaattggtctacccaattataga |
118 |
Q |
| |
|
||||||||| | |||| || ||||||||| ||||||||||||||| | | ||||||| |||||||||||||| |
|
|
| T |
27177407 |
tttggttagacacgcttccagctgagttgtttatggatttctattgtgacataattggtttacccaattataga |
27177480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University