View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_high_77 (Length: 204)
Name: NF7311_high_77
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_high_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 47905511 - 47905327
Alignment:
| Q |
15 |
ctaagtgttctcattctgcaacatttgaacgctattatgcaatatgcttaaataactcactaacgaaatcaattgcatcactcac---aacattgtatac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
47905511 |
ctaagtgttctcattctgcaacatttgaacgctattatgcaatatgcttaaataactcactaacgaaatcaattgcatcactcacaacaacattgcatac |
47905412 |
T |
 |
| Q |
112 |
atttttatccctctaccccaattataaagacttcattccttctcataatgcatatatgaaatgatgtaaaacctgtgtcataatt |
196 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47905411 |
aattttatccctctgccccaattataaagacttcattccttctcataatgcatatatgaaatgatgtaaaacctgtgtcataatt |
47905327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University