View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_52 (Length: 249)
Name: NF7311_low_52
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_52 |
 |  |
|
| [»] chr7 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 122 - 249
Target Start/End: Complemental strand, 7357683 - 7357556
Alignment:
| Q |
122 |
ctcttgtttctctgcatttcaaacttataaaaatgcctcactctttttgaatttttaggcaaaatcacagttacactatttcgctggaaaataaaaaatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7357683 |
ctcttgtttctctgcatttcaaacttataaaaaagcctcactctttttgaatttttaggcgaaatcacagttacactatttcgctggaaaataaaaaacc |
7357584 |
T |
 |
| Q |
222 |
tcactcttttctagctttttcgtagaaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7357583 |
tcactcttttctagctttttcgtagaaa |
7357556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 126 - 240
Target Start/End: Complemental strand, 29791806 - 29791691
Alignment:
| Q |
126 |
tgtttctctgcatttcaaacttataaaaatgcctcactct-ttttgaatttttaggcaaaatcacagttacactatttcgctggaaaat-aaaaaatctc |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||||||||||| ||| ||||||||||| ||||| ||||| ||| ||| |||||||||| |
|
|
| T |
29791806 |
tgtttctctgcatttcaaccttataaaaaaacctcactcttttttgaattttccggcgaaatcacagtt-cactacttcgccggagaataaaaaaatctc |
29791708 |
T |
 |
| Q |
224 |
actcttttctagctttt |
240 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
29791707 |
actcttttctaactttt |
29791691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 7357773 - 7357707
Alignment:
| Q |
35 |
tagaaaaataataaatannnnnnngtcattccgtaatcgatgattcatgtgcgattcctctctctct |
101 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7357773 |
tagaaaaataataaatatttttttgtcattccacaatcgatgattcatgtgcgattcctctctctct |
7357707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 47
Target Start/End: Complemental strand, 7357891 - 7357858
Alignment:
| Q |
14 |
gggcccggcttggatcgtgggtagaaaaataata |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
7357891 |
gggccgggcttggatcgtgggtagaaaaataata |
7357858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University