View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_56 (Length: 241)
Name: NF7311_low_56
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 38802917 - 38803148
Alignment:
| Q |
2 |
gattttgcaccaaagaaatgtaacttctcaataacaaaatttgaaaacaacttactttgccaaactgatttctggtatgtgccacttttagatatttttt |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38802917 |
gatttttcaccaaagaaatgtaacttctcaataacaaaatgtgaaaacaacttactttgccaaactgatttctggtatgtgccacttttagatatttttt |
38803016 |
T |
|
| Q |
102 |
gacaaaatgtgccacttttagatataagtcagcatta--------nnnnnnnnnnnnaagttgaataactacaataacttttcccccctaaagaaaacca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38803017 |
gacaaaatgtgccacttttagatataagtcagcattattttttatttatttatttttaagttgaataactacaataacttttcccccctaaagaaaacca |
38803116 |
T |
|
| Q |
194 |
atgaatattgctaccaatacactcttgatatc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38803117 |
atgaatattgctaccaatacactcttgatatc |
38803148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University