View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_6 (Length: 614)
Name: NF7311_low_6
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 451 - 604
Target Start/End: Complemental strand, 53035524 - 53035364
Alignment:
| Q |
451 |
ttttcttttgaaataaaataataattataatt-------atttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt |
543 |
Q |
| |
|
|||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53035524 |
ttttcttttgaaataaaataataattattagttttggaaatttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt |
53035425 |
T |
 |
| Q |
544 |
gggtttagggttttagcgatggcgtctcgaccagagcgggtggcaccacctgagatattct |
604 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53035424 |
gggtttagggttttagcgatggcgtctcgaccagagcgggtggcaccacctgagatattct |
53035364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University