View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7311_low_6 (Length: 614)

Name: NF7311_low_6
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7311_low_6
NF7311_low_6
[»] chr4 (1 HSPs)
chr4 (451-604)||(53035364-53035524)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 451 - 604
Target Start/End: Complemental strand, 53035524 - 53035364
Alignment:
451 ttttcttttgaaataaaataataattataatt-------atttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt 543  Q
    |||||||||||||||||||||||||||| | |       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53035524 ttttcttttgaaataaaataataattattagttttggaaatttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt 53035425  T
544 gggtttagggttttagcgatggcgtctcgaccagagcgggtggcaccacctgagatattct 604  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53035424 gggtttagggttttagcgatggcgtctcgaccagagcgggtggcaccacctgagatattct 53035364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University