View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_69 (Length: 234)
Name: NF7311_low_69
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 111 - 217
Target Start/End: Original strand, 8103068 - 8103174
Alignment:
| Q |
111 |
cctattgcctgaaaactgtttcccggtcgatgaactaatgaccttacctgccccatgcgcaaaaagttgaactattctttctataataggttggatgagt |
210 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
8103068 |
cctattgcctgaaaaccgtttccgggtcgatgaactaatgaccttacctgccccatgcgcaaaaagttgaactattctttttataataggttggataagt |
8103167 |
T |
|
| Q |
211 |
gaattat |
217 |
Q |
| |
|
||||||| |
|
|
| T |
8103168 |
gaattat |
8103174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 106
Target Start/End: Complemental strand, 51691874 - 51691837
Alignment:
| Q |
69 |
gcagagccgagcctccggattcgtaggaactgccctgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51691874 |
gcagagccgagcctccggattcgtaggaacggccctgt |
51691837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 106
Target Start/End: Complemental strand, 39134671 - 39134637
Alignment:
| Q |
72 |
gagccgagcctccggattcgtaggaactgccctgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39134671 |
gagccgagcctccggattcgtaggaacggccctgt |
39134637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 105
Target Start/End: Original strand, 18201283 - 18201319
Alignment:
| Q |
69 |
gcagagccgagcctccggattcgtaggaactgccctg |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18201283 |
gcagagccgagcctccggattcgtgggaacggccctg |
18201319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University