View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_70 (Length: 233)
Name: NF7311_low_70
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 38625044 - 38624929
Alignment:
| Q |
1 |
tgaagataaaataaacatgcactcatctatatggatttcacattcaatgaagtggtatagaagcatcgacccaagtttagaaaactatggggaatttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625044 |
tgaagataaaataaacatgcactcatctatatggatttcacattcaatgaagtggtatagaagcatcgacccaagtttagaaaactatggggaatttact |
38624945 |
T |
|
| Q |
101 |
gtcactactaccatgt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38624944 |
gtcactactaccatgt |
38624929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 38650096 - 38650014
Alignment:
| Q |
1 |
tgaagataaaataaacatgcactcatctatatggatttcacattcaatgaagtggtatagaagcatcgacccaagtttagaaa |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38650096 |
tgaagataaaataaacatgcactcatctatatcgatttcacagtcagtgaagtggtatagaagcatcaacccaagtttagaaa |
38650014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 38624876 - 38624830
Alignment:
| Q |
169 |
gaactgaactatgtgcatttaaaaattatttaatttgtggaaaaaac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624876 |
gaactgaactatgtgcatttaaaaattatttaatttgtggaaaaaac |
38624830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University