View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7311_low_84 (Length: 204)

Name: NF7311_low_84
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7311_low_84
NF7311_low_84
[»] chr5 (1 HSPs)
chr5 (33-182)||(2638027-2638176)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 33 - 182
Target Start/End: Original strand, 2638027 - 2638176
Alignment:
33 tggttcggtttcatttcatgcgaaattggtgattttgcctaaa-ctaacacaatgaacaaatagattgattatgatttggtttgttcatattataaaaaa 131  Q
    ||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||    
2638027 tggttcggtttcatttcatacgaaattgatgattttgcctaaaactaacacaatgaaaaaatagattgattatggtttggtttgttcatattataaaaaa 2638126  T
132 gtgagaaattgcaacaacaacaaaaaagttataaacgtgtgcctctgccct 182  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||    
2638127 gtgagaaattgcaacaacaa-aaaaaagttataaacgtgtgcctctgccct 2638176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University