View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7311_low_84 (Length: 204)
Name: NF7311_low_84
Description: NF7311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7311_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 33 - 182
Target Start/End: Original strand, 2638027 - 2638176
Alignment:
| Q |
33 |
tggttcggtttcatttcatgcgaaattggtgattttgcctaaa-ctaacacaatgaacaaatagattgattatgatttggtttgttcatattataaaaaa |
131 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2638027 |
tggttcggtttcatttcatacgaaattgatgattttgcctaaaactaacacaatgaaaaaatagattgattatggtttggtttgttcatattataaaaaa |
2638126 |
T |
 |
| Q |
132 |
gtgagaaattgcaacaacaacaaaaaagttataaacgtgtgcctctgccct |
182 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2638127 |
gtgagaaattgcaacaacaa-aaaaaagttataaacgtgtgcctctgccct |
2638176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University