View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7313_low_15 (Length: 259)
Name: NF7313_low_15
Description: NF7313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7313_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 31083051 - 31083238
Alignment:
| Q |
1 |
aatttttatttaccaaatacattataaagtgtaaatttattaagaaatatgattcacttttgcttaaaaaataataaatatgattaattttgtaaactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31083051 |
aatttttatttaccaaatacattataaagtgtaaatttattaagaaatatgattcacttttgcttaaaaaataataaatatgattaattttgtaaactag |
31083150 |
T |
|
| Q |
101 |
taatatgtcgtccatcaacaagtttattaannnnnnnaaaatttgcataacnnnnnnnattcagaaaacttaaacaaacattaattctttt |
191 |
Q |
| |
|
|||||| |||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31083151 |
taatat---gtccattaacaagtttattaattttttaaaaatttgcataactttttttattcagaaaacttaaacaaacattaattctttt |
31083238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 176 - 247
Target Start/End: Original strand, 31083253 - 31083324
Alignment:
| Q |
176 |
aaacattaattcttttatcatgttatatgtagcaaatgtttgattaattaactaatctatgtcaaggatatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31083253 |
aaacattaattcttttatcatgttatatgtagcaaatgtttgattaattaactaatctatgtcaaggatatt |
31083324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University