View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7313_low_17 (Length: 243)
Name: NF7313_low_17
Description: NF7313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7313_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 25628757 - 25628547
Alignment:
| Q |
11 |
atattattcttaaagttgaaataaaaaactccagcatcacgatctcgctaagtcgttacaataccaacacttgtgtacaattaagtattggtttttgaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25628757 |
atattattcttaaagttgaaataaaaa-ctctagcatcacgatctcactaagtcgttacaataccaacacttgtgtacaattaagtattggtttttgaga |
25628659 |
T |
 |
| Q |
111 |
gatagaactaaatattattaataataataagaacacaattttatatgtgtcctccatgataatctttttgattaggagaaccccctccagccaccccaga |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25628658 |
gatagaactaagtattattaataataataacaacacaattttatatgtgtcctccatgataatctttttgattaggagaaccccctccagccaccccaga |
25628559 |
T |
 |
| Q |
211 |
accacctccagg |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25628558 |
accacctccagg |
25628547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University