View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7314_high_2 (Length: 307)
Name: NF7314_high_2
Description: NF7314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7314_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 99 - 292
Target Start/End: Original strand, 36946329 - 36946523
Alignment:
| Q |
99 |
aagtttggctggtttg-ttgatgttgacttctgatgtcattctacatgcaggaatttcattcagctgatactttccggtgataatagtggaagggttttg |
197 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
36946329 |
aagtttggctggttttattggtgctgacttctgatgtcattctacatgcaggaatttcattcagctgatactttctggtgacaatagtgggagggttttg |
36946428 |
T |
 |
| Q |
198 |
aaatacaattctgccaccaaggaaaccactgttcttgtgagaaacgttcaatttccaaatgggatttccttaagcaaggatgattccttctttgt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36946429 |
aaatacaattctgccaccaaggaaaccaccgttcttgttagaaacattcaatttccaaatgggatttccttaagcaaggatggttccttctttgt |
36946523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 146 - 292
Target Start/End: Complemental strand, 17768394 - 17768248
Alignment:
| Q |
146 |
caggaatttcattcagctgatactttccggtgataatagtggaagggttttgaaatacaattctgccaccaaggaaaccactgttcttgtgagaaacgtt |
245 |
Q |
| |
|
|||||||||||| |||||| || ||||||| ||| ||||||||| ||||||||||||||| |||| || ||||||||||||||||| ||||| || ||| |
|
|
| T |
17768394 |
caggaatttcatgcagctggtattttccggggatgatagtggaaaggttttgaaatacaaccctgcaacaaaggaaaccactgttctagtgaggaatgtt |
17768295 |
T |
 |
| Q |
246 |
caatttccaaatgggatttccttaagcaaggatgattccttctttgt |
292 |
Q |
| |
|
||||| |||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
17768294 |
caattcccaaatggcatttccttaagcaaagattgttccttctttgt |
17768248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University