View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7315_high_19 (Length: 239)

Name: NF7315_high_19
Description: NF7315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7315_high_19
NF7315_high_19
[»] chr4 (1 HSPs)
chr4 (1-153)||(31443980-31444132)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 31444132 - 31443980
Alignment:
1 gattgatctaatcattatgtttaagaatgaatccatccatccatcatgtaatacatgtatgacatagattggttttaccctcaaaagaagaaaagaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31444132 gattgatctaatcattatgtttaagaatgaatccatccatccatcatgtaatacatgtatgacatagattggttttaccctcaaaagaagaaaagaaaaa 31444033  T
101 tcaacaaacttgtaaaggacacataatttcatattccaaaaccatcacaagag 153  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||    
31444032 tcaacaatcttgtaaaggacacataatttcatattccaaaaccatcacaagag 31443980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University