View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7315_low_13 (Length: 316)
Name: NF7315_low_13
Description: NF7315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7315_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 11 - 300
Target Start/End: Original strand, 37714454 - 37714743
Alignment:
| Q |
11 |
cagagattcagaatgaagaaaaagagaaattgaaaactaacttcgattagcaatgttacgagcaatttcttctgaagggagattaaccaaatggaaagga |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37714454 |
cagagattcagaatgaagaaaaggagaaattgaaaactaacttcgattagcaatgttacgagcaatttcttctgaagggagattaaccaaatggaaagga |
37714553 |
T |
 |
| Q |
111 |
gaatctgggtggtgatgaagagggagcttccattgcaattggggatgaacgtcgtcgttttggttgtcatcaaaagctccaaacaatttggctaaagatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37714554 |
gaatctgggtggtgatgaagagggagcttccattgcaattggggatgaacgtcgtcgttttggttgtcatcaaaagctccaaacaatttggctaaagatt |
37714653 |
T |
 |
| Q |
211 |
caacttcgggtttcctgtaatccaataacctgtgaaagaaaacacatagataccacatggttttgttgtctcttcagaaatcgaagaaac |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37714654 |
caacttcgggttttctgtaatccaataacctgtgaaagaaaacacatagataccacatggttttgttgtctcttcagaaatcgaagaaac |
37714743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University