View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7315_low_16 (Length: 258)
Name: NF7315_low_16
Description: NF7315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7315_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 31444126 - 31444242
Alignment:
| Q |
1 |
atcaatcatttttgttatatgaaactacacgggtcagtctcaacattcggttgaggcttaagtaagaaatattaaattgaacttagcgtatgactccaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
31444126 |
atcaatcatttttgttatatgaaactacacgggtcagtctcaacattcggttgaggcttaagtaagaaatattaaattgaacttagcgtatgattcgaga |
31444225 |
T |
|
| Q |
101 |
ttatggaatcaattgaa |
117 |
Q |
| |
|
|||| |||| ||||||| |
|
|
| T |
31444226 |
ttatagaattaattgaa |
31444242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 116 - 181
Target Start/End: Original strand, 31444289 - 31444356
Alignment:
| Q |
116 |
aattcgcatagtgattttgacatatctaatgattattcgagatttcattattt--aagttggtcatac |
181 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31444289 |
aattctcacagtgattttgacatatctaataattattcgagatttcattatttaaaagttggtcatac |
31444356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 31444394 - 31444431
Alignment:
| Q |
182 |
gtgaccaacttaaataatgaaacacgtctataattgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31444394 |
gtgaccaacttaaataatgaaacacgtctacaattgtt |
31444431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University