View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7315_low_20 (Length: 237)
Name: NF7315_low_20
Description: NF7315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7315_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 43076168 - 43076291
Alignment:
| Q |
1 |
ttttgtcacttgagaaccaaacacttagaaattagaatgtaatattaattaaaaatgaaataaattgtgaatccattccattacctttcaccagaagatt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43076168 |
ttttgtcacttgagagccaaacacttagaaattagaatgtaatattaattaaaaatgaaataaattgtgaatccattccattacctttcaccagaagatt |
43076267 |
T |
 |
| Q |
101 |
cctcataaacctgaagcaaacatt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43076268 |
cctcataaacctgaagcaaacatt |
43076291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 152 - 223
Target Start/End: Original strand, 43076319 - 43076390
Alignment:
| Q |
152 |
gttaacttgttattttaaagttcttgcaaataaaacgtaataaataatttgatagaaacaatataaacttat |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43076319 |
gttaacttggtattttaaagttcttgcaaataaaacgtaataaataatttgattgaaacaatataaacttat |
43076390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University