View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7316_high_10 (Length: 328)
Name: NF7316_high_10
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7316_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 155 - 311
Target Start/End: Complemental strand, 6032802 - 6032646
Alignment:
| Q |
155 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgatagattcattcttgatattgcagaaaagttggatct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032802 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgatagattcattcttgatattgcagaaaagttggatct |
6032703 |
T |
 |
| Q |
255 |
tccagtggcagcatcattgttattattattagcatcccaatttggtgataacattgg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032702 |
tccagtggcagcatcattgttattattattagcatcccaatttggtgataacattgg |
6032646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 6032952 - 6032871
Alignment:
| Q |
11 |
agaatatgctgaaaaatatcagctaatatcgatttggactggtattgcaatcctcccatgattttccaaagatttgaagccc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032952 |
agaatatgctgaaaaatatcagctaatatcgatttggactggtattgcaatcctcccatgattttccaaagatttgaagccc |
6032871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 6713012 - 6712976
Alignment:
| Q |
56 |
tgcaatcctcccatgattttccaaagatttgaagccc |
92 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
6713012 |
tgcattcctcccatgattttccaaagatttggagccc |
6712976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University