View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7316_high_13 (Length: 281)
Name: NF7316_high_13
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7316_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 52565500 - 52565231
Alignment:
| Q |
1 |
gcctcttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccctaatagttgaataattattgctgctgctattatctgttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565500 |
gcctcttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccctaatagttgaataattattgctgctgctattatctgttcct |
52565401 |
T |
 |
| Q |
101 |
tgtggtgacagtggttgcttttgatcttcaaacttaatctgcttagagttgcttgttaagttagaactgcccgtttgatcagaaatcatcatcttcttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52565400 |
tgtggtgacagtggttgcttttgatcttcaaacttaatctgtttagagttgcttgttaagttagaactgcccgtttgatcagaaaccatcatcttcttca |
52565301 |
T |
 |
| Q |
201 |
ttattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttgattgttattcat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565300 |
ttattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttgattgttattcat |
52565231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 6 - 62
Target Start/End: Original strand, 16954777 - 16954833
Alignment:
| Q |
6 |
ttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccctaa |
62 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
16954777 |
ttggtccacttctccagagaggggtcttagttgtgtggcaatcagtacaaaccctaa |
16954833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University