View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7316_high_19 (Length: 216)
Name: NF7316_high_19
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7316_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 44308596 - 44308777
Alignment:
| Q |
18 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44308596 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
44308695 |
T |
|
| Q |
118 |
ttatgattgcggtgttgttggcgacggacctactcaatgcgatagaataatggctgatgcgcatattgttaaccctgctatt |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44308696 |
ttatgattgcggtgttgttggtgacggacctactcaatgcgatagaataatggctgatgcgcatattgttaaccctgctatt |
44308777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 44194637 - 44194818
Alignment:
| Q |
18 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44194637 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
44194736 |
T |
|
| Q |
118 |
ttatgattgcggtgttgttggcgacggacctactcaatgcgatagaataatggctgatgcgcatattgttaaccctgctatt |
199 |
Q |
| |
|
|||||||||| |||| || || |||||||||||||| |||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
44194737 |
ttatgattgcaaagttgctgttgatggacctactcaatgtgatagagtaatggctgatgagcatattgttaaccctgctatt |
44194818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 44301071 - 44301252
Alignment:
| Q |
18 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44301071 |
atccaaaacttgaaacatgtgcaggttttgcttatgatggagtagtagggtctttcaaaagttgcttgggtgaaatcactgaggatcctcaaactgctag |
44301170 |
T |
|
| Q |
118 |
ttatgattgcggtgttgttggcgacggacctactcaatgcgatagaataatggctgatgcgcatattgttaaccctgctatt |
199 |
Q |
| |
|
|||||||||| |||| || || |||||||||||||| |||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
44301171 |
ttatgattgcaaagttgctgttgatggacctactcaatgtgatagagtaatggctgatgagcatattgttaaccctgctatt |
44301252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University