View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7316_low_15 (Length: 297)
Name: NF7316_low_15
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7316_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 26 - 295
Target Start/End: Original strand, 8458336 - 8458611
Alignment:
| Q |
26 |
ttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggggtgtgtatggtcagcgcaaatttatatgcatttttcttatttcgtatgg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8458336 |
ttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggggtgtgtatggtcagcgcaactttatatgcatttttcttatttcgtatgg |
8458435 |
T |
 |
| Q |
126 |
aaactacaagcctggttatggtataattgatttatgtaaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaaggaatagaag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458436 |
aaactacaagcctggttatggtataattgatttatgtaaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaaggaatagaag |
8458535 |
T |
 |
| Q |
226 |
ggatatttaggtttaaaggttactgattaataagg------ttacccactgcgaatatgacatattcttcgacatc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
8458536 |
ggatatttaggtttaaaggttactgattaataaggtgccttttaaccactgcgaatatgacattttcttctacatc |
8458611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University