View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7316_low_19 (Length: 259)

Name: NF7316_low_19
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7316_low_19
NF7316_low_19
[»] chr8 (1 HSPs)
chr8 (21-226)||(9026877-9027085)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 226
Target Start/End: Original strand, 9026877 - 9027085
Alignment:
21 tataccatcatgaactaaaaataattcagggcttaaaacaaatataccattggaacttagttttaggtggatatggggttttctgataatgatatataga 120  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9026877 tataccatcatgaactaaaaataattcagggcttaaaacaaatctaccattggaacttagttttaggtggatatggggttttctgataatgatatataga 9026976  T
121 aatgagtggattaaaatgtagaaacgtattattaggtttatgtttgtaatt---ataatcacagaaaaaagatagggggtatacatcgaatttccatgtg 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||    
9026977 aatgagtggattaaaatgtagaaacgtattattaggtttatgtttgtaattataataatcacagaaaaaagatagggggtatacatcgaatttccatgtg 9027076  T
218 ctgataaag 226  Q
    |||||||||    
9027077 ctgataaag 9027085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University