View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7316_low_24 (Length: 215)
Name: NF7316_low_24
Description: NF7316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7316_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 42 - 202
Target Start/End: Original strand, 27789218 - 27789376
Alignment:
| Q |
42 |
aaatggagattcaacgaatgaaagagttgttatcacttttgttagcattcaaaagtaaccgagttgctcttgttggtggtaatcacaccgcagctagatt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27789218 |
aaatggagattcaacgaatgaaagagttgttatcacttttgttagcattcaaaagtaaccgagttgctcttgttggtggtaatcataccgcagctagatt |
27789317 |
T |
 |
| Q |
142 |
ttgttctcgctaaatatatttacctccgtttctatccacacacccccctctctcctctctc |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27789318 |
ttgttctcgctaa--atatttacctccgtttctatccacacacccccctctctcctctctc |
27789376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University