View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_high_17 (Length: 362)
Name: NF7317_high_17
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 19 - 349
Target Start/End: Complemental strand, 4444967 - 4444634
Alignment:
| Q |
19 |
ggatgatgttgacaaacaaggaattagcaatgatcattaacgacaataaacagaagaggcctctgtgtgtccggtgactctaactgtgtaacttcgcaac |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4444967 |
ggatgatgttgacaaacaaggaa---gcaatgatcattaacgacaataaacagaagaggcctc-gtgtgtccggtgactctaactgtgtaactttgcaac |
4444872 |
T |
|
| Q |
119 |
ctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttttcccggttgatttcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4444871 |
ctctaacaaattactcttttgtcaacaacgcagccgcaaacgtggctttt-gaaatgactgaaaaaacattcaagaatcccttcttcccagttgatttcg |
4444773 |
T |
|
| Q |
219 |
atacttactgatcgttagcagtcgggtaggtcttttgtt--------tttgagacaatgctattgcctatgcatccaagggttatcccattttgtgactc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4444772 |
atacttactgatcgttagcagtcgggtaagtcttttgtttttgggtttttgagacaatgctattgcctatgcatccaagggttatccctttttgtgactc |
4444673 |
T |
|
| Q |
311 |
aatcaaaccaattgagacagcagcaaccaagtttgatgt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444672 |
aatcaaaccaattgagacagcagcaaccaagtttgatgt |
4444634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 348
Target Start/End: Original strand, 37558671 - 37558764
Alignment:
| Q |
255 |
gtttttgagacaatgctattgcctatgcatccaagggttatcccattttgtgactcaatcaaaccaattgagacagcagcaaccaagtttgatg |
348 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37558671 |
gtttttgaggtaatgctattgcctatgcatccaagggttatcccttttttggactcaatcaaaccaattgaagcagcagcaaccaggtttgatg |
37558764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 104 - 235
Target Start/End: Original strand, 37558480 - 37558610
Alignment:
| Q |
104 |
gtgtaacttcgcaacctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttt |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| ||||| | | |||| ||| |||||| ||||||| || ||||| ||||||| | |
|
|
| T |
37558480 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggc-tttcaaaatgactgaaaaatcactcaaggatcccttct |
37558578 |
T |
|
| Q |
204 |
tcccggttgatttcgatacttactgatcgtta |
235 |
Q |
| |
|
|||| |||||||| |||||||| || |||||| |
|
|
| T |
37558579 |
tcccagttgatttggatacttattgttcgtta |
37558610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 34257710 - 34257758
Alignment:
| Q |
255 |
gtttttgagacaatgctattgcctatgcatccaagggttatcccatttt |
303 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
34257710 |
gtttttgaagcaatgctattgcctacgcatccaacggttatcccgtttt |
34257758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University