View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7317_high_34 (Length: 209)

Name: NF7317_high_34
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7317_high_34
NF7317_high_34
[»] chr3 (2 HSPs)
chr3 (87-152)||(11616049-11616114)
chr3 (17-59)||(11616115-11616157)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 87 - 152
Target Start/End: Complemental strand, 11616114 - 11616049
Alignment:
87 cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctt 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11616114 cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctt 11616049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 11616157 - 11616115
Alignment:
17 attcttatttgatgaacatatgcatagatcttgagtggattaa 59  Q
    |||||||||||||||| ||||||||||||||||||||||||||    
11616157 attcttatttgatgaaaatatgcatagatcttgagtggattaa 11616115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University