View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_high_35 (Length: 206)
Name: NF7317_high_35
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 28 - 191
Target Start/End: Complemental strand, 16555581 - 16555407
Alignment:
| Q |
28 |
ttatacattccacacacggaatctttctttcaactttttagtttccttcaaaattactcaaaaagtcattttcattag-----------taaagagcttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16555581 |
ttatacattccacacacggaatctttctttcaactttttagtttccttcaaaattactcaaaaagtcattttcattagaaaattttcactaaagagcttg |
16555482 |
T |
|
| Q |
117 |
aacacataattaaatctagacggcaccgtttggagtgttattggggtctctctagtgagtggtccacttaattat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16555481 |
aacacataattaaatctagacggcaccgtttggagtgttattggggtctctctagtgagtggtccacttaattat |
16555407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University