View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_13 (Length: 432)
Name: NF7317_low_13
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 8e-68; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 272 - 414
Target Start/End: Complemental strand, 27419827 - 27419685
Alignment:
| Q |
272 |
ggaagattttcttagtatgattctggcgacgattctgagaaatctaagtccattatctagccaactattctatgttatccttcttttttgagggaatatt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
27419827 |
ggaagattttcttagtatgattctggcgacgattctgagaaatctaagtccattatctggccaactattatatgttatccttctttttttagggaatatt |
27419728 |
T |
|
| Q |
372 |
gtatggtatcttttttaatttatgcaaattccacgttatctct |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27419727 |
gtatggtatcttttttaatttatgcaaattccacgttatctct |
27419685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 90 - 257
Target Start/End: Complemental strand, 27419979 - 27419815
Alignment:
| Q |
90 |
atgtgatttagagggcatgtgtgtgggaggatctgaggtacaaacattgagggaaaagggagattcttacatattttatcctttttcatttcatgcataa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27419979 |
atgtgatttagagggcatgtgtgtggga---tatgaggtaca--cattgagggataagggagattcttacatattttatcccttttcatttcatgcataa |
27419885 |
T |
|
| Q |
190 |
aacgtcaaatttgtatagtac--gcctatcagatcatttcgacatataaccggagaaggaagattttctt |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
27419884 |
aacgtcaaatttgtatagtactagcctatcagatcatatcgacatataacaggagaaggaagattttctt |
27419815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 27420113 - 27420078
Alignment:
| Q |
1 |
acaaagtggaatttgagtttggcagaacaaactcaa |
36 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27420113 |
acaaagtggaatttgagtttggcggaacaaactcaa |
27420078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University