View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_17 (Length: 390)
Name: NF7317_low_17
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 41243488 - 41243692
Alignment:
| Q |
1 |
atgttgctcaatttgcattaaaacctttgactttccctgatttctttgacttcaaattaaatgacaaataaaacctttttcacacacattgcttcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41243488 |
atgttgctcaatttgcattaaaacctttgactttccctgatttctttgacttcaaattaaatgacaaataaaacctttttcacacacattgcttcaaaat |
41243587 |
T |
 |
| Q |
101 |
ctcattttcgtaattgagggtgacaatggcagaaataaatcatataacaaatactctttggatttccaaatacattccttgtgattttatttttcaggac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41243588 |
ctcattttcgtaattgagggtgacaatgacagaaataaatcatataacaaatactctttggatttccaaatacattccttgtgattttatctttcaggac |
41243687 |
T |
 |
| Q |
201 |
aaatt |
205 |
Q |
| |
|
||||| |
|
|
| T |
41243688 |
aaatt |
41243692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 270 - 373
Target Start/End: Original strand, 41243755 - 41243858
Alignment:
| Q |
270 |
gaaataatcattatacacatggataaaatcattatagtggtgttctcataagtttaactcacttgacaagggataaatataatgcaaaatatatgcaagg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| | ||||||||||| |
|
|
| T |
41243755 |
gaaataatcattatacacatggataaaatcattatagtggtgttctcataaatttaactcacttgataagggataaatataatgcatattatatgcaagg |
41243854 |
T |
 |
| Q |
370 |
ggtc |
373 |
Q |
| |
|
|||| |
|
|
| T |
41243855 |
ggtc |
41243858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University