View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_24 (Length: 301)
Name: NF7317_low_24
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 8382615 - 8382507
Alignment:
| Q |
16 |
ctttctgcaaataaacgctatctcaatctcgcagattcgggtttgtgaatatgataaagaatatgatacgaacaagggttatataggaaataaataattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8382615 |
ctttctgcaaataaacgctatctcaatctcgcagattcgggtttgtgaatatgatacgaacttggctacaaacaagggttatataggaaataaataattg |
8382516 |
T |
|
| Q |
116 |
gtttatttc |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
8382515 |
atttatttc |
8382507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 293
Target Start/End: Complemental strand, 8382415 - 8382335
Alignment:
| Q |
213 |
aagtttgcaaaaatatatgccacacattgtgttcttattcgatttgttggattagtctcttcagttatgcacagtataatc |
293 |
Q |
| |
|
||||||||||||||||||| || |||||||||| | ||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
8382415 |
aagtttgcaaaaatatatgttactaattgtgttctcactcgatttgttggattagtctcttcaattatgcacggtataatc |
8382335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University